crispr-guide-design — independently scanned and version-tracked by SaferSkills.
SaferSkills independently audited crispr-guide-design (Agent Skill) and scored it 100/100 (green). The audit ran 55 deterministic rules across Security, Supply Chain, Maintenance, Transparency, and Community; it found 0 high-severity and 0 lower-severity findings. The full rule-by-rule trace and per-finding evidence are below. Free, methodology-open.
Findings & checks · 0 flagged
Every scanned point with the score it earned and what moved between them.
First recorded scan — no prior version to compare against.
The primary manifest — the file an agent reads to learn what this artifact does.
Automate sgRNA selection, scoring, off-target evaluation, and oligo generation for CRISPR experiments using the documented workflow.
python3 Skills/Genomics/CRISPR_Design_Agent/crispr_designer.py \
--sequence "ATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTGTGAGTGGATCCATTGGAAGGGC" \
--output guides.jsonavoid_variants is true.README.md and prompt.md for detailed schema plus supporting literature.~30 seconds. Free. No account. Every finding cites a rule and a line of evidence.