bio-workflows-smrna-pipeline — independently scanned and version-tracked by SaferSkills.
SaferSkills independently audited bio-workflows-smrna-pipeline (Agent Skill) and scored it 100/100 (green). The audit ran 55 deterministic rules across Security, Supply Chain, Maintenance, Transparency, and Community; it found 0 high-severity and 0 lower-severity findings. The full rule-by-rule trace and per-finding evidence are below. Free, methodology-open.
Findings & checks · 0 flagged
Every scanned point with the score it earned and what moved between them.
First recorded scan — no prior version to compare against.
The primary manifest — the file an agent reads to learn what this artifact does.
Reference examples tested with: DESeq2 1.42+, cutadapt 4.4+
Before using code patterns, verify installed versions match. If versions differ:
packageVersion('<pkg>') then ?function_name to verify parameters<tool> --version then <tool> --help to confirm flagsIf code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
"Analyze my small RNA-seq data from FASTQ to differential miRNAs" → Orchestrate adapter trimming (cutadapt), miRNA quantification (miRDeep2/miRge3), novel miRNA discovery, differential expression (DESeq2), and target prediction (miRanda).
FASTQ → cutadapt trim → miRDeep2 → Quantification → DESeq2 → Target prediction# Adapter trimming and size selection
cutadapt -a TGGAATTCTCGGGTGCCAAGG \
--minimum-length 18 --maximum-length 30 \
-o trimmed.fastq.gz reads.fastq.gz# Align to genome
mapper.pl trimmed.fastq.gz -e -h -i -j -l 18 \
-m -p genome_index -s reads_collapsed.fa \
-t reads_collapsed_vs_genome.arf
# miRNA quantification and novel prediction
miRDeep2.pl reads_collapsed.fa genome.fa \
reads_collapsed_vs_genome.arf \
mature_ref.fa none hairpin_ref.falibrary(DESeq2)
counts <- read.csv('mirna_counts.csv', row.names = 1)
dds <- DESeqDataSetFromMatrix(counts, colData, ~condition)
dds <- DESeq(dds)
results <- results(dds)# miRanda for target prediction
miranda mature_mirnas.fa target_3utrs.fa -out targets.txt~30 seconds. Free. No account. Every finding cites a rule and a line of evidence.