bio-small-rna-seq-smrna-preprocessing — independently scanned and version-tracked by SaferSkills.
SaferSkills independently audited bio-small-rna-seq-smrna-preprocessing (Agent Skill) and scored it 100/100 (green). The audit ran 55 deterministic rules across Security, Supply Chain, Maintenance, Transparency, and Community; it found 0 high-severity and 0 lower-severity findings. The full rule-by-rule trace and per-finding evidence are below. Free, methodology-open.
Findings & checks · 0 flagged
Every scanned point with the score it earned and what moved between them.
First recorded scan — no prior version to compare against.
The primary manifest — the file an agent reads to learn what this artifact does.
Reference examples tested with: cutadapt 4.4+, fastp 0.23+, matplotlib 3.8+
Before using code patterns, verify installed versions match. If versions differ:
pip show <package> then help(module.function) to check signatures<tool> --version then <tool> --help to confirm flagsIf code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
"Preprocess my small RNA-seq reads" → Remove 3' adapter sequences and size-select reads in the small RNA range (18-30 nt for miRNA, 24-32 nt for piRNA) before quantification or discovery.
cutadapt -a ADAPTER -m 18 -M 30 -o trimmed.fastq input.fastqGoal: Remove 3' adapter sequences and size-select reads in the small RNA range.
Approach: Run cutadapt with the kit-specific adapter, minimum/maximum length filters, and discard reads without adapter.
Small RNA libraries have specific 3' adapters that must be removed:
# Standard Illumina TruSeq small RNA adapter
cutadapt \
-a TGGAATTCTCGGGTGCCAAGG \
-m 18 \
-M 30 \
--discard-untrimmed \
-o trimmed.fastq.gz \
input.fastq.gz
# -a: 3' adapter sequence
# -m 18: Minimum length (miRNAs are 18-25 nt)
# -M 30: Maximum length (exclude longer fragments)
# --discard-untrimmed: Remove reads without adapter (likely not small RNA)| Kit | 3' Adapter Sequence |
|---|---|
| Illumina TruSeq | TGGAATTCTCGGGTGCCAAGG |
| NEBNext | AGATCGGAAGAGCACACGTCT |
| QIAseq | AACTGTAGGCACCATCAAT |
| Lexogen | TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC |
# Filter by length after trimming
cutadapt \
-a TGGAATTCTCGGGTGCCAAGG \
-m 18 -M 26 \
-o mirna_length.fastq.gz \
input.fastq.gz
# miRNA: 18-26 nt (typically 21-23 nt)
# piRNA: 26-32 nt
# snoRNA: variable, typically longer# Trim low-quality bases from 3' end before adapter removal
cutadapt \
-q 20 \
-a TGGAATTCTCGGGTGCCAAGG \
-m 18 \
-o trimmed.fastq.gz \
input.fastq.gz# fastp with small RNA settings
fastp \
--in1 input.fastq.gz \
--out1 trimmed.fastq.gz \
--adapter_sequence TGGAATTCTCGGGTGCCAAGG \
--length_required 18 \
--length_limit 30 \
--html report.html
# Note: fastp auto-detects adapters but specifying is more reliableFor small RNAs, collapsing identical sequences reduces computation:
# Using seqkit
seqkit rmdup -s trimmed.fastq.gz -o collapsed.fasta
# Using fastx_toolkit (legacy)
fastx_collapser -i trimmed.fastq -o collapsed.fastaimport gzip
from collections import Counter
def collapse_reads(fastq_path):
'''Collapse identical sequences and count occurrences'''
counts = Counter()
with gzip.open(fastq_path, 'rt') as f:
while True:
header = f.readline()
if not header:
break
seq = f.readline().strip()
f.readline() # +
f.readline() # qual
# Only keep reads in miRNA size range
if 18 <= len(seq) <= 26:
counts[seq] += 1
return counts
# Write collapsed FASTA
def write_collapsed_fasta(counts, output_path):
with open(output_path, 'w') as f:
for i, (seq, count) in enumerate(counts.most_common()):
f.write(f'>seq_{i}_x{count}\n{seq}\n')Key metrics to check:
import matplotlib.pyplot as plt
from collections import Counter
def plot_length_distribution(fastq_path):
lengths = Counter()
with gzip.open(fastq_path, 'rt') as f:
for i, line in enumerate(f):
if i % 4 == 1: # Sequence line
lengths[len(line.strip())] += 1
plt.bar(lengths.keys(), lengths.values())
plt.xlabel('Read Length')
plt.ylabel('Count')
plt.title('Small RNA Length Distribution')
plt.savefig('length_dist.png')~30 seconds. Free. No account. Every finding cites a rule and a line of evidence.