Version Compatibility

Reference examples tested with: BioPython 1.83+, samtools 1.19+

Before using code patterns, verify installed versions match. If versions differ:

• Python: pip show <package> then help(module.function) to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

Reverse Complement

Generate complementary and reverse complementary sequences using Biopython.

"Get the reverse complement" → Produce the 5'-to-3' sequence of the opposite strand.

• Python: seq.reverse_complement() (BioPython Seq)
• CLI: samtools faidx ref.fa region --reverse-complement

Required Import

from Bio.Seq import Seq

Core Methods

reverse_complement()

Returns the reverse complement (5' to 3' of the opposite strand).

seq = Seq('ATGCGATCG')
rc = seq.reverse_complement()  # Returns Seq('CGATCGCAT')

This is the most commonly used operation - it gives you the sequence of the opposite strand in the conventional 5' to 3' direction.

complement()

Returns the complement without reversing.

seq = Seq('ATGCGATCG')
comp = seq.complement()  # Returns Seq('TACGCTAGC')

Less commonly used - gives the opposite strand but in 3' to 5' direction.

reverse_complement_rna()

For RNA sequences (uses U instead of T):

rna = Seq('AUGCGAUCG')
rc_rna = rna.reverse_complement_rna()  # Returns Seq('CGAUCGCAU')

complement_rna()

rna = Seq('AUGCGAUCG')
comp_rna = rna.complement_rna()  # Returns Seq('UACGCUAGC')

Base Pairing Rules

DNA

RNA

Ambiguous Bases (IUPAC)

Biopython handles IUPAC ambiguity codes correctly.

Code Patterns

Basic Reverse Complement

seq = Seq('ATGCGATCGATCG')
rc = seq.reverse_complement()
print(f'Original: 5\'-{seq}-3\'')
print(f'RevComp:  5\'-{rc}-3\'')

Visualize Double-Stranded DNA

def show_dsdna(seq):
    comp = seq.complement()
    print(f"5'-{seq}-3'")
    print(f"   {'|' * len(seq)}")
    print(f"3'-{comp}-5'")

seq = Seq('ATGCGATCG')
show_dsdna(seq)

Check if Sequence is Palindrome (Self-Complementary)

def is_palindrome(seq):
    return seq == seq.reverse_complement()

seq1 = Seq('GAATTC')  # EcoRI site - palindrome
seq2 = Seq('ATGCGA')  # Not a palindrome
print(f'GAATTC is palindrome: {is_palindrome(seq1)}')
print(f'ATGCGA is palindrome: {is_palindrome(seq2)}')

Reverse Complement a FASTA File

Goal: Produce a new FASTA file with all sequences reverse-complemented.

Approach: Parse records, create new SeqRecords with .reverse_complement(), write to output.

from Bio import SeqIO
from Bio.SeqRecord import SeqRecord

def reverse_complement_records(records):
    for record in records:
        yield SeqRecord(
            record.seq.reverse_complement(),
            id=record.id + '_rc',
            description=record.description + ' reverse complement'
        )

records = SeqIO.parse('sequences.fasta', 'fasta')
SeqIO.write(reverse_complement_records(records), 'sequences_rc.fasta', 'fasta')

Primer Design Helper

def design_primer_pair(template, start, end):
    '''Design forward and reverse primers for a region'''
    forward = template[start:start + 20]
    reverse = template[end - 20:end].reverse_complement()
    return forward, reverse

template = Seq('ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCG')
fwd, rev = design_primer_pair(template, 0, 40)
print(f'Forward primer (5\'-3\'): {fwd}')
print(f'Reverse primer (5\'-3\'): {rev}')

Handle Both Strands in Analysis

Goal: Search for a motif on both DNA strands.

Approach: Search the forward sequence, then search its reverse complement. Convert positions on the reverse strand back to forward-strand coordinates.

def search_both_strands(seq, motif):
    '''Search for a motif on both strands'''
    motif = Seq(motif)
    results = []
    pos = seq.find(motif)
    while pos != -1:
        results.append(('+', pos))
        pos = seq.find(motif, pos + 1)
    rc = seq.reverse_complement()
    pos = rc.find(motif)
    while pos != -1:
        results.append(('-', len(seq) - pos - len(motif)))
        pos = rc.find(motif, pos + 1)
    return results

seq = Seq('ATGCGAATTCGATCGATGAATTCGATC')
hits = search_both_strands(seq, 'GAATTC')
for strand, pos in hits:
    print(f'Found on {strand} strand at position {pos}')

Common Use Cases

Common Errors

Decision Tree

Need to work with strand orientation?
├── Get opposite strand sequence (5' to 3')?
│   └── Use reverse_complement()
├── Get base-paired sequence (same direction)?
│   └── Use complement()
├── Working with RNA?
│   └── Use reverse_complement_rna()
├── Check if restriction site (palindrome)?
│   └── seq == seq.reverse_complement()
└── Designing primers?
    └── Reverse primer = reverse_complement() of 3' end

Related Skills

• seq-objects - Create Seq objects to complement
• transcription-translation - Six-frame translation uses reverse complement
• motif-search - Search both strands for motifs
• restriction-analysis/restriction-sites - Restriction sites are often palindromic
• alignment-files/sam-bam-basics - BAM FLAG indicates read strand; use samtools view -f 16 for reverse